CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
Reference examples tested with: CRISPOR 5.01+, BioPython 1.83+, pandas 2.2+, numpy 1.26+, Azimuth 2.0+ (Doench 2016), CRISPRon 1.0+ (Xiang 2021), DeepSpCas9 1.0+ (Kim 2019).
Before using code patterns, verify installed versions match. If versions differ:
crispor.py --help from the crisporWebsite cloneazimuth.model_comparison.predict(...)If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Design a CRISPR library for my screen" -> Pick a chemistry (Cas9 KO, CRISPRi, CRISPRa, Cas12a, base or prime editor), score candidate guides for on-target activity and off-target liability, position them relative to gene/TSS, add appropriate controls, lay out the oligo for synthesis, and validate the cloned pool.
crispor.py (web + CLI) for batch genome-wide guide scoring with CFD+MIT off-targetazimuth (Microsoft Research) for Rule Set 2 on-target predictions (Brunello-style)CRISPRon, DeepSpCas9 for modern deep-learning predictorscrisprDesign (Bioconductor) for integrated annotation-aware design| Goal | Chemistry | Canonical library | Guides/gene | TSS / target window | |------|-----------|-------------------|-------------|---------------------| | Loss-of-function essentiality, fitness | SpCas9 KO | Brunello, TKOv3, Avana | 4 (Brunello), 4 (TKOv3), 6 (Avana) | Constitutive exons, prefer aa 5-65% from N-terminus | | Knockdown of non-cuttable genes, dosage-sensitive | dCas9-KRAB (CRISPRi) | Dolcetto, Horlbeck v2 | 6 (Dolcetto), 5 (Horlbeck) | Optimum +25 to +75 downstream of FANTOM5 TSS, searched out to -50/+300 (Dolcetto, Sanson 2018); -25 to +500 (Horlbeck v2) | | Gain-of-function, gene activation | dCas9-VP64 / SAM / SunTag (CRISPRa) | Calabrese, Horlbeck-CRISPRa | 6 (Calabrese), 5 (Horlbeck) | -150 to -75 from TSS (Calabrese); -550 to -25 (Horlbeck v2) | | Paralog buffering, GI screens | enAsCas12a multiplex | Inzolia, in4mer | 4-guide arrays | Constitutive exons | | Variant function, SNV scanning | CBE / ABE | Custom tiling library | Tile editing windows | Editing window pos 4-8 from PAM-distal end | | Precise edit, indel-free | Prime editor | Custom PRIDICT-designed | Tile pegRNAs | Anywhere with NGG PAM within 30 nt of edit |
Fails when:
| Predictor | Year | Training set | Strengths | Fails when | |-----------|------|--------------|-----------|------------| | Doench Rule Set 1 | 2014 | Flow-sorted GFP+ knockouts | Simple, interpretable | Limited training data; sub-optimal at >NGG context | | Doench Rule Set 2 / Azimuth 2.0 | 2016 | 1,841 flow-cytometry guides (Doench 2014) plus new guides tiling additional genes | Gold-standard for SpCas9; basis of Brunello | Trained on dropouts; under-predicts efficacy for nuclear-localized targets | | DeepSpCas9 | 2019 | 12,832 synthetic targets integrated in HEK293T | Spearman ~0.77 vs measured indel frequency on held-out data | Black-box; sensitive to chromatin/context features it wasn't trained on | | CRISPRon | 2021 | High-throughput indel sequencing | Best for therapeutic-grade target nomination | Slow per-guide; over-fits to its specific cell line | | DeepHF | 2019 | ~171k guides in HEK293T (WT 55,604; eSpCas9(1.1) 58,167; HF1 56,888) | Separate model per enzyme variant, including WT | Pick the model matching the enzyme actually used |
Reconciliation: When predictors disagree, prefer the model whose training cell line matches the screen line (DeepSpCas9 was trained on synthetic targets integrated in HEK293T). For Brunello selection, Azimuth/Rule Set 2 is sufficient because the library was built with it -- introducing a different scorer creates apples-to-oranges ranking with the original library.
| Score | Year | Math | Cutoff convention | |-------|------|------|--------------------| | MIT (Hsu) | 2013 | Position-weighted mismatch penalty | Specificity score 0-100, higher is better; CRISPOR treats >=50 as a good guide | | CFD (Doench) | 2016 | Position+nucleotide-specific penalty fit on Brunello | Per-site CFD >0.2 counts a candidate off-target (Doench 2016); CRISPOR's aggregate CFD specificity score is 0-100, higher is better | | Elevation | 2018 | ML on CFD + mismatch positions | Tighter than CFD |
CFD remains the default for genome-wide library design. Critical pitfall: CFD penalizes only mismatches, not bulges; for ≤1 mismatch + 1-bp bulge off-targets, validate empirically with GUIDE-seq or CIRCLE-seq. CRISPOR reports both the MIT (Hsu) and CFD guide specificity scores in a single output.
Goal: Generate ranked sgRNA candidates for a single gene, jointly scored on on-target activity (Rule Set 2 / Azimuth) and off-target liability (CFD).
Approach: Identify all PAM-adjacent 20-nt protospacers in the target gene's coding sequence, retain only those in the first 5-65% of the protein (constitutive-exon convention from Brunello), filter on GC 30-70% and absence of poly-T (≥4 Ts terminates U6), call Azimuth for on-target and CRISPOR for off-target, and select the top N satisfying both criteria.
import re
import pandas as pd
import numpy as np
from Bio.Seq import Seq
def find_sgrna_candidates(cds_sequence, pam='NGG', guide_length=20):
'''Return all protospacer candidates with PAM coordinates on + strand.
Caller must filter by exon position and Azimuth/CFD score.'''
pam_pattern = re.compile(f'(?=([ACGT]{{{guide_length}}}{pam.replace("N", "[ACGT]")}))')
candidates = []
for strand, seq in [('+', cds_sequence), ('-', str(Seq(cds_sequence).reverse_complement()))]:
for m in pam_pattern.finditer(seq):
spacer = m.group(1)[:guide_length]
if 'TTTT' in spacer or spacer.count('G') + spacer.count('C') not in range(6, 15):
continue
candidates.append({'spacer': spacer, 'strand': strand,
'pos_in_cds': m.start() if strand == '+' else len(seq) - m.start() - 23,
'gc_frac': (spacer.count('G') + spacer.count('C')) / guide_length})
return pd.DataFrame(candidates)
def annotate_exon_position(candidates_df, cds_length):
'''Filter to protospacers within first 5-65% of CDS (Brunello convention).
Reason: N-terminal indels truncate protein; very-N-terminal hits alt initiation;
C-terminal hits miss functional domains (Doench 2016 Nat Biotech).'''
lo, hi = 0.05 * cds_length, 0.65 * cds_length
return candidates_df[(candidates_df['pos_in_cds'] >= lo) & (candidates_df['pos_in_cds'] <= hi)].copy()
Goal: Position guides relative to the empirical TSS for maximum knockdown (CRISPRi) or activation (CRISPRa).
Approach: Resolve TSS from FANTOM5 CAGE peaks (highest-ranked peak per gene; fall back to Ensembl/RefSeq if absent), define the modality-specific window, score candidate spacers in that window with Rule Set 2 plus the Horlbeck/Sanson CRISPRi/a-tailored rules, and select 5-6 guides per gene biased toward the window center.
def crispri_window(tss_coord, strand='+'):
'''Dolcetto convention: search -50 to +300 around the FANTOM5 highest-rank CAGE peak.
Reason: Sanson 2018 found +25 to +75 nt downstream of the TSS optimal for CRISPRi,
so rank candidates toward that band; the search is relaxed outward to fill the
per-gene guide quota when poorly-annotated TSSs leave too few candidates.'''
if strand == '+':
return (tss_coord - 50, tss_coord + 300)
return (tss_coord - 300, tss_coord + 50)
def crispra_window(tss_coord, strand='+'):
'''Calabrese convention: -150 to -75 upstream of TSS.
Reason: dCas9-VP64 (and SAM, SunTag) activate maximally when bound
just upstream of Pol II loading. Horlbeck v2 CRISPRa uses -550 to -25
(broader, lower per-guide signal). For SAM, prefer Calabrese tightness;
for SunTag, Horlbeck width is acceptable.'''
if strand == '+':
return (tss_coord - 150, tss_coord - 75)
return (tss_coord + 75, tss_coord + 150)
Critical nuance: Cell-type-specific TSSs differ from the FANTOM5 consensus in ~15% of genes. For tissue-specific screens (e.g., neuron, hepatocyte), re-derive TSSs from a matched CAGE / GRO-seq / PRO-seq dataset before locking guide positions, or knockdown efficiency drops several-fold. The single most common cause of "weak" CRISPRi hits is mis-positioned guides against an alternative TSS.
| Library | Year | Modality | Size (genes x guides) | sgRNA rules | Notable | |---------|------|----------|-----------------------|-------------|---------| | GeCKOv2 | 2014 | Cas9 KO | ~19k x 6 (~123k) | Exon position + off-target specificity (predates Rule Set 1) | Older; legacy datasets still use it | | Avana | 2016 | Cas9 KO | 110,257 as published; DepMap screens a ~4-guide subset (Meyers 2017: 70,086 after filtering, 17,670 genes) | Rule Set 1 | Still the Broad's primary Cas9 library; CERES->Chronos changed in 2021, not the library | | Brunello | 2016 | Cas9 KO | ~19k x 4 (~77k) | Rule Set 2 + CFD | Modern standard for new screens | | TKOv3 | 2017 | Cas9 KO | ~18k x 4 (~71k) | Hart on/off-target | Bagel/BAGEL2-optimized | | Humagne | 2020 | enAsCas12a | ~19.8k x 1 dual-guide construct (~20k per set) | enAsCas12a rules | Compact Cas12a sets C and D | | Horlbeck CRISPRi v2 | 2016 | dCas9-KRAB | ~18k x 5 (~104k) | Horlbeck CRISPRi rules | First-gen, still widely used | | Dolcetto | 2018 | dCas9-KRAB | ~19k x 3 per set (114,061 across Sets A+B) | Horlbeck + Rule Set 2 | Modern CRISPRi standard | | Horlbeck CRISPRa | 2016 | dCas9-VP64 | ~18k x 5 (~104k) | Horlbeck CRISPRa rules | Original CRISPRa | | Calabrese | 2018 | dCas9-VP64 | ~18.9k x 3 per set (113,238 across Sets A+B) | Tight TSS window | Modern CRISPRa standard | | Inzolia | 2024 | enAsCas12a | ~49k arrays: 19,687 genes (2 arrays each) plus ~4,435 paralog pairs | enAsCas12a rules | Paralog-pair multiplex; ~30% smaller than a typical Cas9 library | | in4mer | 2024 | Cas12a (4-guide) | Custom | enAsCas12a multiplex | Triple/quadruple KO per cassette |
dAUC trajectory (essentiality benchmark): GeCKOv2 < Avana < Brunello/TKOv3 (Doench 2016 + Hart 2017). Moving from 4 to 6 sgRNAs/gene gives diminishing returns; the larger gain is moving from Rule Set 1 to Rule Set 2.
Cost-coverage tradeoff: A 77k-guide Brunello at 500x cells/sgRNA needs 38.5M cells in pool, scalable. A 117k-guide Calabrese at 500x needs 59M cells -- often the deciding factor against CRISPRa for difficult-to-grow lines.
| Enzyme | PAM | Spacer length | Best for | |--------|-----|---------------|----------| | SpCas9 (WT) | NGG | 20 nt | Standard pooled screens; broadest library support | | eSpCas9, SpCas9-HF1 | NGG | 20 nt | Lower off-target rate; use for therapeutic-grade nomination | | SpCas9-NG | NG | 20 nt | Expanded targeting (~4x coverage); accept lower activity per guide | | SpRY | NRN / NYN | 20 nt | Near-PAMless; coverage at every position; ~50% lower per-guide activity | | SaCas9 | NNGRRT | 21 nt | AAV-packageable (small ORF); rarely used in pooled screens | | AsCas12a, LbCas12a | TTTV | 23 nt | AT-rich regions; staggered cut; lower expression noise | | enAsCas12a (DeWeirdt 2021) | Expanded TTTV + several non-canonical | 23 nt | Combinatorial / paralog screens |
Decision rule: If the screen requires every possible TSS position (saturation tiling, dense regulatory dissection), use SpRY despite lower activity; otherwise, NGG is best because the on-target predictors were trained on it.
A genome-wide library should include:
| Control type | Count | Purpose | |--------------|-------|---------| | Non-targeting (scrambled, no genomic match) | 500-1,000 (~1% of library) | Primary null distribution for CRISPRi/a; safe baseline for normalization | | Safe-harbor (AAVS1, ROSA26-equivalent) | 50-100 | Cas9-only: absorbs cut-toxicity baseline (matters for amplicon-correction) | | Olfactory receptors (presumed non-expressed) | 50-100 | Second null set for orthogonal normalization | | Reference essentials (CEGv2 subset: e.g. RPS3, RPL11, EIF3A, POLR2A) | 50-100 | Internal positive control; QC dropout signal | | Reference non-essentials (NEGv1 subset) | 50-100 | Internal negative control; BAGEL2 calibration |
Critical pitfall: Using only AAVS1 as the negative control in a Cas9 screen creates a normalization baseline biased toward "any cut is bad." Always add NTCs or non-essentials so that downstream median normalization and PR-AUC against CEGv2 work without baseline-shift artifacts.
Paralog buffering (Cas12a multiplex): Build 4-guide arrays where positions 1-2 target gene A and positions 3-4 target paralog gene B. Inzolia covers ~4,435 paralog pairs within ~49k arrays. Singleton controls (gene A alone, gene B alone) must be included to score genetic interaction = double_KO_LFC - sum(single_KO_LFC).
Base editor screens (tiling-library design): Tile NGG-adjacent spacers across exons; ensure editing window (positions 4-8 from PAM-distal end) lands inside coding exons; flag bystander Cs/As in the window for downstream interpretation. Restrict to 50-90% editing efficiency a priori (filter out predicted low-efficacy guides) -- see [[base-editing-analysis]].
Tiling / regulatory dissection: Dense (every 5-10 bp) CRISPRi or CRISPRa guides across the candidate region; CRISPRi has broader signal width (good for enhancer discovery) but Cas9-indel tiling has sharper resolution (good for pinpointing critical bases). Pair with CRISPR-SURF deconvolution.
Goal: Generate the final oligo sequence ready for chip-based synthesis. Vendor limits differ: Twist oligo pools cap at ~300 nt per oligo with no fixed pool size, GenScript's 92K format spans 20-170 nt, and Agilent OLS 244K spans 30-230 nt.
Approach: Add subpool PCR primers (so multiple sublibraries can share a synthesis array), the BsmBI/Esp3I overhang for golden-gate cloning into LentiGuide-Puro (Addgene 52963) or LentiCRISPRv2, and append the tracrRNA scaffold if the array length permits.
def build_oligo(spacer, vector='lentiGuide-Puro', subpool_idx=None):
'''Construct final oligo for pooled synthesis.
LentiGuide-Puro / LentiCRISPRv2 use BsmBI (Esp3I) with these overhangs:
forward: 5'-CACCG[spacer]-3'
reverse: 5'-AAAC[revcomp(spacer)]C-3'
For chip synthesis, the spacer is flanked by subpool-specific PCR primers.'''
subpool_fwd = {
1: 'GGAAAGGACGAAACACCG', # subpool 1 forward primer + BsmBI overhang
2: 'GAGGCACTGGGCAGGTACCG',
}.get(subpool_idx, 'GGAAAGGACGAAACACCG')
# First 33 nt of the Chen 2013 sgRNA(F+E) optimized scaffold. NOTE: lentiGuide-Puro (#52963)
# and lentiCRISPRv2 (#52961) carry the ORIGINAL scaffold; F+E belongs to lentiCRISPRv2-Opti (#163126).
scaffold_short = 'GTTTAAGAGCTATGCTGGAAACAGCATAGCAAG'
oligo = subpool_fwd + spacer + scaffold_short
if len(oligo) > 200:
raise ValueError(f'Oligo length {len(oligo)} exceeds the 200 nt design budget; check the vendor limit')
return oligo
Subpool design: A large synthesis pool can be partitioned into multiple sublibraries via subpool primers; each sub-PCR amplifies its subpool, allowing one synthesis batch to serve several screens. Typical subpool size: 10k-20k oligos.
| Metric | Target | Failure mode if missed | |--------|--------|------------------------| | sgRNA detection (>25 reads/guide in plasmid pool) | ≥99% | Founder effect: missing guides cannot be screened; dropout impossible to distinguish from missing | | Gini coefficient of plasmid pool | <0.1 | Synthesis defects or PCR bias; pool unfit for screening at standard 500x coverage | | Skew ratio (top 10% / bottom 10%) | <2 (good), <5 (acceptable) | Skew >5 means underrepresented guides cannot generate statistical signal even at 1000x | | % zero-count sgRNAs in plasmid pool | <0.5% | Plasmid bottleneck during cloning; re-amplify or re-clone | | Replicate Pearson on plasmid pool (between sequencing technical replicates) | >0.99 | Sequencing artifact, not biology |
Plasmid pool sequencing convention: 200-500 reads per sgRNA before any biology (i.e. 15-40M reads for a 77k Brunello). This is the baseline against which all downstream depletion is computed; sequencing the plasmid is non-negotiable.
Trigger: Using Ensembl/RefSeq TSS instead of empirical CAGE peak for genes with broad or non-canonical promoters. Mechanism: dCas9-KRAB knockdown is maximal within ±100 bp of the actual Pol II loading site; canonical annotation can be off by 1-10 kb. Symptom: "Easy" essentials (RPS, RPL, EIF) show normal dropout but newer genes don't; library validates poorly against CEGv2. Fix: Re-derive TSS from FANTOM5 CAGE highest-rank peak; for tissue-specific lines, use matched CAGE or GRO-seq.
Trigger: Amplifying the cloned plasmid pool with too many PCR cycles (>20) or with high-GC-bias polymerase. Mechanism: GC-extreme guides amplify nonlinearly; high-GC guides dominate, low-GC guides drop out. Symptom: Gini >0.2 on plasmid pool; sgRNAs with GC <30% systematically depleted. Fix: Cap PCR at 15 cycles; use Q5 or NEBNext Ultra II (low-bias); sequence at 500x post-amp to confirm Gini.
Trigger: Chip-synthesis errors at homopolymer runs or guides starting with GGGG. Mechanism: Synthesis chemistry has higher error rate at low-complexity regions; missing oligos cannot be cloned. Symptom: Specific guides absent from plasmid pool despite no design-rule violation. Fix: Re-design replacement guides; for production runs, request 2-3x synthesis depth so dropouts are buffered.
Trigger: Infection at MOI >0.5 to "save cells." Mechanism: Poisson math: at MOI 0.3, 26% of all cells are infected and 4% carry >=2 sgRNAs (14% of the infected fraction); at MOI 0.5, 39% are infected and 9% carry >=2. Symptom: Hits include neutral genes that co-infect with true essentials. Fix: MOI 0.3 strict; titer Cas9-positive cells specifically; re-check by qPCR of integration.
Trigger: <100 non-targeting controls in a 70k library. Mechanism: Null distribution for normalization and FDR rests on the NTC variance; too few NTCs yields unstable median and inflated FDR. Symptom: Erratic gene-level p-values; MAGeCK FDR fluctuates wildly between runs. Fix: ~1% of library (500-1,000) NTCs; supplement with non-essential-gene controls.
| Threshold | Value | Source / Rationale | |-----------|-------|--------------------| | GC content | 30-70% | Doench 2016 Nat Biotech: guides outside this range have low activity | | Poly-T avoidance | ≤3 consecutive T | U6 Pol III terminator; ≥4 Ts terminates sgRNA transcription | | Guides per gene (Cas9) | 4 (Brunello/TKOv3 standard); up to 6 (Avana, older) | Doench 2016 reports diminishing gene recovery below 4 sgRNAs/gene; returns flatten above 6 | | CRISPRi window | -50 to +300 search; +25 to +75 optimum | Sanson 2018 (Dolcetto); Horlbeck v2 uses -25 to +500 | | CRISPRa window | -150 to -75 from TSS | Sanson 2018 (Calabrese); narrower than Horlbeck v2 (-550 to -25) | | NTCs in library | ~1% (500-1,000 in a 70k library) | DepMap library design notes; rule-of-thumb for stable null | | MOI | 0.3 | Poisson: P(>=2 sgRNAs/cell) = 4% at MOI 0.3 | | Coverage at infection | 500 cells/sgRNA | DepMap convention; 200x minimum, 1000x for noisy / in-vivo | | CRISPOR MIT specificity score | >=50 (higher = more specific) | CRISPOR convention (Haeussler 2016) | | Library skew (top 10% / bottom 10%) | <2 ideal, <5 acceptable | Joung 2017 Nat Protoc |
| Error / symptom | Cause | Solution |
|-----------------|-------|----------|
| sgRNA fails to express | Poly-T in spacer terminates U6 | Filter TTTT in design; this is the #1 silent failure |
| CRISPRi guide gives no knockdown | Wrong TSS used | Re-derive TSS from FANTOM5 / matched CAGE |
| Library Gini >0.3 in plasmid pool | PCR over-amplification or synthesis defect | Cap at 15 cycles; re-sequence plasmid; consider re-synthesis |
| Hits include amplified loci (e.g. ERBB2 in HER2+) | Copy-number amplicon false-essentiality | See [[copy-number-correction]] |
| Paralog gene absent from hit list despite expression | Cas9 single-KO buffering | Switch to Cas12a multiplex; see [[combinatorial-screens]] |
| Cas12a oligo doesn't cut | Forgot Cas12a's TTTV PAM is 5' of spacer, not 3' | Re-orient: PAM-then-spacer for Cas12a, opposite of Cas9 |
npx skills add GPTomics/bio-crispr-screens-library-design下载完整 Skill 目录,包含 SKILL.md 及所有相关文件
Category:science-education